circad | circRNAs associated with diseases

hsa_circRNA_101975
Gene	n/a	Organism	Human
Genome Locus	n/a	Build	hg19
Disease	Osteoarthritis (OA)	ICD-10	Polyarthrosis, unspecified (M15.9)
DBLink	Link to database	PMID	28624198
Experimental Method
Sample Type	Cartilage	Comparison	OA cartilage was isolated from the knee joints of 30 patients undergoing total knee arthroplasty
Method for Estimation	Quantitative PCR and Microarrays	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward GCCCAAACCAGACCTCACTT Reverse TCCTTCTCGGGCTCCTGA	Statistics	Fold Change : Upregulated pvalue : p<0.05
Citation
Liu, Q, Zhang, X, Hu, X, Yuan, L, Cheng, J, Jiang, Y, Ao, Y (2017). Emerging Roles of circRNA Related to the Mechanical Stress in Human Cartilage Degradation of Osteoarthritis. Mol Ther Nucleic Acids, 7:223-230.